:: National Centre of Applied Human Genetics ::

National Centre of Applied Human Genetics
HOME LINKS CONTACT US
:: National Centre of Applied Human Genetics ::
ncagh.org - Activity Report
Pubmed.com
 
www.pubmed.com
 
Database
Database Information

Nucleotide, Protein and OMIM

Coordinator

PROF. R.N.K. BAMEZAI
     Ph.D.; F.N.A.Sc.; F.I.M.S.A; F.A.M.S; F.N.A.

Photo Gallery
News

Activity Report - NCAHG

ncahg.org

Nucleotide, Protein, OMIM and Citations in the Genbank Database Information

Nucleotide Database Information

1: EU872049
  Homo sapiens isolate 9523 mitochondrion, complete genome
gi|194268018|gb|EU872049.1|[194268018]
2: EU872048
  Homo sapiens isolate R114 mitochondrion, complete genome
gi|194268004|gb|EU872048.1|[194268004]
3: EU872047
  Homo sapiens isolate P798 mitochondrion, complete genome
gi|194267990|gb|EU872047.1|[194267990]
4: EU872046
  Homo sapiens isolate R143 mitochondrion, complete genome
gi|194267976|gb|EU872046.1|[194267976]
5: EU872045
  Homo sapiens isolate 444 mitochondrion, complete genome
gi|194267962|gb|EU872045.1|[194267962]
6: EU872044
  Homo sapiens isolate KU40 mitochondrion, complete genome
gi|194267948|gb|EU872044.1|[194267948]
7: EU872043
  Homo sapiens isolate SV23 mitochondrion, complete genome
gi|194267934|gb|EU872043.1|[194267934]
8: EU872042
  Homo sapiens isolate DN36 mitochondrion, complete genome
gi|194267920|gb|EU872042.1|[194267920]
9: EU872041
  Homo sapiens isolate SV24 mitochondrion, complete genome
gi|194267906|gb|EU872041.1|[194267906]
10: EU872040
  Homo sapiens isolate DN33 mitochondrion, complete genome
gi|194267892|gb|EU872040.1|[194267892]
11: EU872039
  Homo sapiens isolate R45 mitochondrion, complete genome
gi|194267878|gb|EU872039.1|[194267878]
12: EU872038
  Homo sapiens isolate SK2 mitochondrion, complete genome
gi|194267864|gb|EU872038.1|[194267864]
13: EU872037
  Homo sapiens isolate R24 mitochondrion, complete genome
gi|194267850|gb|EU872037.1|[194267850]
14: EU872036
  Homo sapiens isolate 23 mitochondrion, complete genome
gi|194267836|gb|EU872036.1|[194267836]
15: EU872035
  Homo sapiens isolate 21 mitochondrion, complete genome
gi|194267822|gb|EU872035.1|[194267822]
16: EU872034
  Homo sapiens isolate 9410 mitochondrion, complete genome
gi|194267808|gb|EU872034.1|[194267808]
17: EU872033
  Homo sapiens isolate 94 mitochondrion, complete genome
gi|194267794|gb|EU872033.1|[194267794]
18: EU872032
  Homo sapiens isolate AJ18 mitochondrion, complete genome
gi|194267780|gb|EU872032.1|[194267780]
19: EU872031
  Homo sapiens isolate LR4 mitochondrion, complete genome
gi|194267766|gb|EU872031.1|[194267766]
20: EU872030
  Homo sapiens isolate R13 mitochondrion, complete genome
gi|194267752|gb|EU872030.1|[194267752]
21: EU872029
  Homo sapiens isolate R15 mitochondrion, complete genome
gi|194267738|gb|EU872029.1|[194267738]
22: EU563241
  Homo sapiens clone B07 ATPase subunit 6 (ATP6) and cytochrome c oxidase subunit III (COX3) genes, partial cds; mitochondrial
gi|187729690|gb|EU563241.1|[187729690]
23: EU239590
  Homo sapiens isolate PH-20 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948103|gb|EU239590.1|[160948103]
24: EU239536
  Homo sapiens isolate pH1E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948049|gb|EU239536.1|[160948049]
25: EU181364
  Homo sapiens isolate PH88Yb control region, partial sequence; mitochondrial
gi|158266574|gb|EU181364.1|[158266574]
26: EU181363
  Homo sapiens isolate PHY2b control region, partial sequence; mitochondrial
gi|158266573|gb|EU181363.1|[158266573]
27: EU181362
  Homo sapiens isolate PH25Y2b control region, partial sequence; mitochondrial
gi|158266572|gb|EU181362.1|[158266572]
28: EU181361
  Homo sapiens isolate PH76Y2b control region, partial sequence; mitochondrial
gi|158266571|gb|EU181361.1|[158266571]
29: EU181360
  Homo sapiens isolate PH98Y2 control region, partial sequence; mitochondrial
gi|158266570|gb|EU181360.1|[158266570]
30: EU181359
  Homo sapiens isolate PH85Yb control region, partial sequence; mitochondrial
gi|158266569|gb|EU181359.1|[158266569]
31: EU181358
  Homo sapiens isolate PH24Y2b control region, partial sequence; mitochondrial
gi|158266568|gb|EU181358.1|[158266568]
32: EU181357
  Homo sapiens isolate PH77Y2b control region, partial sequence; mitochondrial
gi|158266567|gb|EU181357.1|[158266567]
33: EU181356
  Homo sapiens isolate PH86Y2b control region, partial sequence; mitochondrial
gi|158266566|gb|EU181356.1|[158266566]
34: EU181355
  Homo sapiens isolate PH9bY2 control region, partial sequence; mitochondrial
gi|158266565|gb|EU181355.1|[158266565]
35: EU181354
  Homo sapiens isolate PH97Y2b control region, partial sequence; mitochondrial
gi|158266564|gb|EU181354.1|[158266564]
36: EU181353
  Homo sapiens isolate PH79Y2b control region, partial sequence; mitochondrial
gi|158266563|gb|EU181353.1|[158266563]
37: EU181352
  Homo sapiens isolate PH28Y2 control region, partial sequence; mitochondrial
gi|158266562|gb|EU181352.1|[158266562]
38: EU181351
  Homo sapiens isolate PH93Y2b control region, partial sequence; mitochondrial
gi|158266561|gb|EU181351.1|[158266561]
39: EU181350
  Homo sapiens isolate PH75Yb control region, partial sequence; mitochondrial
gi|158266560|gb|EU181350.1|[158266560]
40: EU181349
  Homo sapiens isolate PH92Y2 control region, partial sequence; mitochondrial
gi|158266559|gb|EU181349.1|[158266559]
41: EU181348
  Homo sapiens isolate pH47m control region, partial sequence; mitochondrial
gi|158266558|gb|EU181348.1|[158266558]
42: EU181347
  Homo sapiens isolate pH32m control region, partial sequence; mitochondrial
gi|158266557|gb|EU181347.1|[158266557]
43: EU181346
  Homo sapiens isolate pH38m control region, partial sequence; mitochondrial
gi|158266556|gb|EU181346.1|[158266556]
44: EU181345
  Homo sapiens isolate pH42m control region, partial sequence; mitochondrial
gi|158266555|gb|EU181345.1|[158266555]
45: EU181344
  Homo sapiens isolate pH28m control region, partial sequence; mitochondrial
gi|158266554|gb|EU181344.1|[158266554]
46: EU181343
  171:
Homo sapiens isolate pH44m control region, partial sequence; mitochondrial
gi|158266553|gb|EU181343.1|[158266553]
47: EU181342
  Homo sapiens isolate pH46m control region, partial sequence; mitochondrial
gi|158266552|gb|EU181342.1|[158266552]
48: EU181341
  Homo sapiens isolate pH25m control region, partial sequence; mitochondrial
gi|158266551|gb|EU181341.1|[158266551]
49: EU181340
  174:
Homo sapiens isolate pH35am control region, partial sequence; mitochondrial
gi|158266550|gb|EU181340.1|[158266550]
50: EU181339
  175:
Homo sapiens isolate pH36m control region, partial sequence; mitochondrial
gi|158266549|gb|EU181339.1|[158266549]
51: EU181338
  Homo sapiens isolate pH39m control region, partial sequence; mitochondrial
gi|158266548|gb|EU181338.1|[158266548]
52: EU181337
  Homo sapiens isolate pH29m control region, partial sequence; mitochondrial
gi|158266547|gb|EU181337.1|[158266547]
53: EU181336
  Homo sapiens isolate pH40m control region, partial sequence; mitochondrial
gi|158266546|gb|EU181336.1|[158266546]
54: EU181335
  Homo sapiens isolate pH26m control region, partial sequence; mitochondrial
gi|158266545|gb|EU181335.1|[158266545]
55: EU181334
  Homo sapiens isolate pH34m control region, partial sequence; mitochondrial
gi|158266544|gb|EU181334.1|[158266544]
56: EU181333
  Homo sapiens isolate pH35bm control region, partial sequence; mitochondrial
gi|158266543|gb|EU181333.1|[158266543]
57: EU181332
  Homo sapiens isolate pH48m control region, partial sequence; mitochondrial
gi|158266542|gb|EU181332.1|[158266542]
58: EU181331
  Homo sapiens isolate pH45m control region, partial sequence; mitochondrial
gi|158266541|gb|EU181331.1|[158266541]
59: EU181330
  184:
Homo sapiens isolate pH49m control region, partial sequence; mitochondrial
gi|158266540|gb|EU181330.1|[158266540]
60: EU181329
  Homo sapiens isolate pH4m control region, partial sequence; mitochondrial
gi|158266539|gb|EU181329.1|[158266539]
61: EU181328
  Homo sapiens isolate pH27m control region, partial sequence; mitochondrial
gi|158266538|gb|EU181328.1|[158266538]
62: EU181327
  Homo sapiens isolate PH26 control region, partial sequence; mitochondrial
gi|158266537|gb|EU181327.1|[158266537]
63: EU181326
  Homo sapiens isolate PH48 control region, partial sequence; mitochondrial
gi|158266536|gb|EU181326.1|[158266536]
64: EU181325
  Homo sapiens isolate PH5 control region, partial sequence; mitochondrial
gi|158266535|gb|EU181325.1|[158266535]
65: EU181324
  Homo sapiens isolate PH35 control region, partial sequence; mitochondrial
gi|158266534|gb|EU181324.1|[158266534]
66: EU181323
  Homo sapiens isolate PH58 control region, partial sequence; mitochondrial
gi|158266533|gb|EU181323.1|[158266533]
67: EU181322
  Homo sapiens isolate PH38 control region, partial sequence; mitochondrial
gi|158266532|gb|EU181322.1|[158266532]
68: EU181321
  Homo sapiens isolate PH47 control region, partial sequence; mitochondrial
gi|158266531|gb|EU181321.1|[158266531]
69: EU181319
  Homo sapiens isolate PH3 control region, partial sequence; mitochondrial
gi|158266529|gb|EU181319.1|[158266529]
70: EU181318
  Homo sapiens isolate PH32 control region, partial sequence; mitochondrial
gi|158266528|gb|EU181318.1|[158266528]
71: EU181317
  Homo sapiens isolate PH28 control region, partial sequence; mitochondrial
gi|158266527|gb|EU181317.1|[158266527]
72: EU181316
  Homo sapiens isolate PH9 control region, partial sequence; mitochondrial
gi|158266526|gb|EU181316.1|[158266526]
73: EU181315
  Homo sapiens isolate PH7 control region, partial sequence; mitochondrial
gi|158266525|gb|EU181315.1|[158266525]
74: EU181314
  Homo sapiens isolate PH34 control region, partial sequence; mitochondrial
gi|158266524|gb|EU181314.1|[158266524]
75: EU181313
  Homo sapiens isolate PH4 control region, partial sequence; mitochondrial
gi|158266523|gb|EU181313.1|[158266523]
76: EU181312
  202:
Homo sapiens isolate PH22 control region, partial sequence; mitochondrial
gi|158266522|gb|EU181312.1|[158266522]
77: EU181311
  Homo sapiens isolate PH46 control region, partial sequence; mitochondrial
gi|158266521|gb|EU181311.1|[158266521]
78: EU181310
  Homo sapiens isolate PH0 control region, partial sequence; mitochondrial
gi|158266520|gb|EU181310.1|[158266520]
79: EU181309
  Homo sapiens isolate PH36 control region, partial sequence; mitochondrial
gi|158266519|gb|EU181309.1|[158266519]
80: EU181308
  Homo sapiens isolate PhaK control region, partial sequence; mitochondrial
gi|158266518|gb|EU181308.1|[158266518]
81: EU181307
  Homo sapiens isolate Ph7aK control region, partial sequence; mitochondrial
gi|158266517|gb|EU181307.1|[158266517]
82: EU181306
  Homo sapiens isolate Ph0K control region, partial sequence; mitochondrial
gi|158266516|gb|EU181306.1|[158266516]
83: EU181305
  Homo sapiens isolate Ph8aK control region, partial sequence; mitochondrial
gi|158266515|gb|EU181305.1|[158266515]
84: EU181304
  Homo sapiens isolate Ph4aK control region, partial sequence; mitochondrial
gi|158266514|gb|EU181304.1|[158266514]
85: EU181303
  Homo sapiens isolate PhK control region, partial sequence; mitochondrial
gi|158266513|gb|EU181303.1|[158266513]
86: EU181302
  Homo sapiens isolate Ph7K control region, partial sequence; mitochondrial
gi|158266512|gb|EU181302.1|[158266512]
87: EU181301
  Homo sapiens isolate Ph24K control region, partial sequence; mitochondrial
gi|158266511|gb|EU181301.1|[158266511]
88: EU181300
  Homo sapiens isolate Ph4K control region, partial sequence; mitochondrial
gi|158266510|gb|EU181300.1|[158266510]
89: EU181299
  Homo sapiens isolate Ph25K control region, partial sequence; mitochondrial
gi|158266509|gb|EU181299.1|[158266509]
90: EU181298
  Homo sapiens isolate Ph9K control region, partial sequence; mitochondrial
gi|158266508|gb|EU181298.1|[158266508]
91: EU181297
  Homo sapiens isolate Ph2K control region, partial sequence; mitochondrial
gi|158266507|gb|EU181297.1|[158266507]
92: EU181296
  Homo sapiens isolate Ph8K control region, partial sequence; mitochondrial
gi|158266506|gb|EU181296.1|[158266506]
93: EU181295
  Homo sapiens isolate Ph20K control region, partial sequence; mitochondrial
gi|158266505|gb|EU181295.1|[158266505]
94: EU181294
  Homo sapiens isolate Ph23K control region, partial sequence; mitochondrial
gi|158266504|gb|EU181294.1|[158266504]
95: EU181293
  Homo sapiens isolate Ph3K control region, partial sequence; mitochondrial
gi|158266503|gb|EU181293.1|[158266503]
96: EU181292
  Homo sapiens isolate Ph5K control region, partial sequence; mitochondrial
gi|158266502|gb|EU181292.1|[158266502]
97: EU181291
  Homo sapiens isolate pH18E control region, partial sequence; mitochondrial
gi|158266501|gb|EU181291.1|[158266501]
98: EU181290
  Homo sapiens isolate pH1E control region, partial sequence; mitochondrial
gi|158266500|gb|EU181290.1|[158266500]
99: EU181289
  Homo sapiens isolate pH8E control region, partial sequence; mitochondrial
gi|158266499|gb|EU181289.1|[158266499]
100: EU181287
  Homo sapiens isolate pH4E control region, partial sequence; mitochondrial
gi|158266497|gb|EU181287.1|[158266497]
101: EU181286
  Homo sapiens isolate pH5E control region, partial sequence; mitochondrial
gi|158266496|gb|EU181286.1|[158266496]
102: EU181285
  Homo sapiens isolate pH3E control region, partial sequence; mitochondrial
gi|158266495|gb|EU181285.1|[158266495]
103: EU181284
  Homo sapiens isolate pH22E control region, partial sequence; mitochondrial
gi|158266494|gb|EU181284.1|[158266494]
104: EU181282
  Homo sapiens isolate Ar38 control region, partial sequence; mitochondrial
gi|158266492|gb|EU181282.1|[158266492]
105: EU181281
  Homo sapiens isolate Ar2a control region, partial sequence; mitochondrial
gi|158266491|gb|EU181281.1|[158266491]
106: EU181280
  Homo sapiens isolate Ar22b control region, partial sequence; mitochondrial
gi|158266490|gb|EU181280.1|[158266490]
107: EU181279
  Homo sapiens isolate Ar22a control region, partial sequence; mitochondrial
gi|158266489|gb|EU181279.1|[158266489]
108: EU181278
  Homo sapiens isolate Ar2 control region, partial sequence; mitochondrial
gi|158266488|gb|EU181278.1|[158266488]
109: EU181277
  Homo sapiens isolate Ar67 control region, partial sequence; mitochondrial
gi|158266487|gb|EU181277.1|[158266487]
110: EU181276
  Homo sapiens isolate Ar20 control region, partial sequence; mitochondrial
gi|158266486|gb|EU181276.1|[158266486]
111: EU181275
  Homo sapiens isolate Ar26 control region, partial sequence; mitochondrial
gi|158266485|gb|EU181275.1|[158266485]
112: EU181274
  Homo sapiens isolate Ar85 control region, partial sequence; mitochondrial
gi|158266484|gb|EU181274.1|[158266484]
113: EU181273
  Homo sapiens isolate Ar74 control region, partial sequence; mitochondrial
gi|158266483|gb|EU181273.1|[158266483]
114: EU181272
  Homo sapiens isolate Ar9Ah2 control region, partial sequence; mitochondrial
gi|158266482|gb|EU181272.1|[158266482]
115: EU181271
  Homo sapiens isolate Ar68 control region, partial sequence; mitochondrial
gi|158266481|gb|EU181271.1|[158266481]
116: EU181270
  Homo sapiens isolate Ar58 control region, partial sequence; mitochondrial
gi|158266480|gb|EU181270.1|[158266480]
117: EU181269
  Homo sapiens isolate Ar53 control region, partial sequence; mitochondrial
gi|158266479|gb|EU181269.1|[158266479]
118: EU181268
  Homo sapiens isolate Ar28 control region, partial sequence; mitochondrial
gi|158266478|gb|EU181268.1|[158266478]
119: EU181267
  Homo sapiens isolate Ar42 control region, partial sequence; mitochondrial
gi|158266477|gb|EU181267.1|[158266477]
120: EU181266
  Homo sapiens isolate Ar56 control region, partial sequence; mitochondrial
gi|158266476|gb|EU181266.1|[158266476]
121: AY642023
  Homo sapiens clone up64 HVRII control region, partial sequence; mitochondrial
gi|50956620|gb|AY642023.1|[50956620]
122: AY642026
  Homo sapiens clone JKR126 HVRII control region, partial sequence; mitochondrial
gi|50919506|gb|AY642026.1|[50919506]
123: AY642025
  Homo sapiens clone JKR131 HVRII control region, partial sequence; mitochondrial
gi|50919505|gb|AY642025.1|[50919505]
124: AY642024
  Homo sapiens clone JKR116 HVRII control region, partial sequence; mitochondrial
gi|50919504|gb|AY642024.1|[50919504]
125: EU600396
  Homo sapiens NADH dehydrogenase subunit 5-like (ND5) gene, partial sequence; mitochondrial
gi|193090102|gb|EU600396.1|[193090102]
126: EU586511
  Homo sapiens isolate 4S-9F cytochrome c oxidase subunit I (cox1) gene, complete cds; mitochondrial
gi|192335152|gb|EU586511.1|[192335152]
127: NM_002284
  Homo sapiens keratin 86 (KRT86), mRNA
gi|109637786|ref|NM_002284.3|[109637786]
128: EU569685
  Homo sapiens isolate E03_350-12f cytochrome c oxidase subunit II (COX2) gene, partial cds; mitochondrial
gi|186968863|gb|EU569685.1|[186968863]
129: NM_001080379
  Homo sapiens PARK2 co-regulated (PACRG), transcript variant 3, mRNA
gi|122939205|ref|NM_001080379.1|[122939205]
130: NM_001080378
  Homo sapiens PARK2 co-regulated (PACRG), transcript variant 2, mRNA
gi|122939201|ref|NM_001080378.1|[122939201]
131: NM_152410
  Homo sapiens PARK2 co-regulated (PACRG), transcript variant 1, mRNA
gi|122939203|ref|NM_152410.2|[122939203]
132: EU239655
  Homo sapiens isolate pH49m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948168|gb|EU239655.1|[160948168]
133: EU239654
  Homo sapiens isolate pH48m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948167|gb|EU239654.1|[160948167]
134: EU239653
  Homo sapiens isolate pH47m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948166|gb|EU239653.1|[160948166]
135: EU239652
  Homo sapiens isolate pH46m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948165|gb|EU239652.1|[160948165]
136: EU239651
  Homo sapiens isolate pH44m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948164|gb|EU239651.1|[160948164]
137: EU239650
  Homo sapiens isolate pH43m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948163|gb|EU239650.1|[160948163]
138: EU239649
  Homo sapiens isolate pH42m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948162|gb|EU239649.1|[160948162]
139: EU239648
  Homo sapiens isolate pH41m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948161|gb|EU239648.1|[160948161]
140: EU239647
  Homo sapiens isolate pH39m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948160|gb|EU239647.1|[160948160]
141: EU239646
  Homo sapiens isolate pH38m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948159|gb|EU239646.1|[160948159]
142: EU239644
  Homo sapiens isolate pH36m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948157|gb|EU239644.1|[160948157]
143: EU239643
  Homo sapiens isolate pH35am D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948156|gb|EU239643.1|[160948156]
144: EU239642
  Homo sapiens isolate pH34m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948155|gb|EU239642.1|[160948155]
145: EU239641
  Homo sapiens isolate pH32m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948154|gb|EU239641.1|[160948154]
146: EU239640
  Homo sapiens isolate pH31m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948153|gb|EU239640.1|[160948153]
147: EU239639
  Homo sapiens isolate pH30m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948152|gb|EU239639.1|[160948152]
148: EU239638
  Homo sapiens isolate pH29m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948151|gb|EU239638.1|[160948151]
149: EU239637
  Homo sapiens isolate pH28m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948150|gb|EU239637.1|[160948150]
150: EU239636
  Homo sapiens isolate pH27m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948149|gb|EU239636.1|[160948149]
151: EU239635
  Homo sapiens isolate pH26m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948148|gb|EU239635.1|[160948148]
152: EU239634
  Homo sapiens isolate pH25m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948147|gb|EU239634.1|[160948147]
153: EU239633
  Homo sapiens isolate pH35m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948146|gb|EU239633.1|[160948146]
154: EU239632
  Homo sapiens isolate PH241Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948145|gb|EU239632.1|[160948145]
155: EU239631
  Homo sapiens isolate PH99Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948144|gb|EU239631.1|[160948144]
156: EU239630
  Homo sapiens isolate PH98Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948143|gb|EU239630.1|[160948143]
157: EU239629
  Homo sapiens isolate PH97Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948142|gb|EU239629.1|[160948142]
158: EU239628
  Homo sapiens isolate PH96Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948141|gb|EU239628.1|[160948141]
159: EU239627
  Homo sapiens isolate PH94Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948140|gb|EU239627.1|[160948140]
160: EU239626
  Homo sapiens isolate PH93Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948139|gb|EU239626.1|[160948139]
161: EU239625
  Homo sapiens isolate PH92Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948138|gb|EU239625.1|[160948138]
162: EU239624
  Homo sapiens isolate PH88Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948137|gb|EU239624.1|[160948137]
163: EU239623
  Homo sapiens isolate PH86Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948136|gb|EU239623.1|[160948136]
164: EU239622
  Homo sapiens isolate PH85Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948135|gb|EU239622.1|[160948135]
165: EU239621
  Homo sapiens isolate PH79Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948134|gb|EU239621.1|[160948134]
166: EU239620
  Homo sapiens isolate PH77Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948133|gb|EU239620.1|[160948133]
167: EU239619
  Homo sapiens isolate PH76Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948132|gb|EU239619.1|[160948132]
168: EU239618
  Homo sapiens isolate PH75Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948131|gb|EU239618.1|[160948131]
169: EU239617
  Homo sapiens isolate PH73Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948130|gb|EU239617.1|[160948130]
170: EU239616
  Homo sapiens isolate PH39Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948129|gb|EU239616.1|[160948129]
171: EU239615
  Homo sapiens isolate PH28Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948128|gb|EU239615.1|[160948128]
172: EU239614
  Homo sapiens isolate PH25Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948127|gb|EU239614.1|[160948127]
173: EU239613
  Homo sapiens isolate PH9bY D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948126|gb|EU239613.1|[160948126]
174: EU239612
  Homo sapiens isolate PH7Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948125|gb|EU239612.1|[160948125]

175: EU239611
  Homo sapiens isolate PH6Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948124|gb|EU239611.1|[160948124]
176: EU239610
  Homo sapiens isolate PH4Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948123|gb|EU239610.1|[160948123]
177: EU239609
  Homo sapiens isolate PH3Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948122|gb|EU239609.1|[160948122]
178: EU239608
  Homo sapiens isolate PH1Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948121|gb|EU239608.1|[160948121]
179: EU239607
  Homo sapiens isolate PH-50 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948120|gb|EU239607.1|[160948120]
180: EU239606
  Homo sapiens isolate PH-49 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948119|gb|EU239606.1|[160948119]
181: EU239605
  Homo sapiens isolate PH-48 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948118|gb|EU239605.1|[160948118]
182: EU239604
  Homo sapiens isolate PH-47 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948117|gb|EU239604.1|[160948117]
183: EU239603
  Homo sapiens isolate PH-46 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948116|gb|EU239603.1|[160948116]
184: EU239602
  Homo sapiens isolate PH-45 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948115|gb|EU239602.1|[160948115]
185: EU239601
  Homo sapiens isolate PH-43 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948114|gb|EU239601.1|[160948114]
186: EU239600
  Homo sapiens isolate PH-38 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948113|gb|EU239600.1|[160948113]
187: EU239599
  Homo sapiens isolate PH-36 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948112|gb|EU239599.1|[160948112]
188: EU239598
  Homo sapiens isolate PH-35 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948111|gb|EU239598.1|[160948111]
189: EU239597
  Homo sapiens isolate PH-34 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948110|gb|EU239597.1|[160948110]

190: EU239596
  Homo sapiens isolate PH-33 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948109|gb|EU239596.1|[160948109]

191: EU239595
  Homo sapiens isolate PH-32 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948108|gb|EU239595.1|[160948108]
192: EU239594
  Homo sapiens isolate PH-31 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948107|gb|EU239594.1|[160948107]

193: EU239593
  Homo sapiens isolate PH-28 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948106|gb|EU239593.1|[160948106]
194: EU239592
  Homo sapiens isolate PH-26 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948105|gb|EU239592.1|[160948105]
195: EU239591
  Homo sapiens isolate PH-22 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948104|gb|EU239591.1|[160948104]
196: EU239590
  Homo sapiens isolate PH-20 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948103|gb|EU239590.1|[160948103]
197: EU239589
  Homo sapiens isolate PH-17 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948102|gb|EU239589.1|[160948102]
198: EU239588
  Homo sapiens isolate PH-14 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948101|gb|EU239588.1|[160948101]
199: EU239587
  Homo sapiens isolate PH-10 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948100|gb|EU239587.1|[160948100]
200: EU239586
  Homo sapiens isolate PH-9 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948099|gb|EU239586.1|[160948099]
201: EU239585
  Homo sapiens isolate PH-5 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948098|gb|EU239585.1|[160948098]
202: EU239584
  Homo sapiens isolate PH-3 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948097|gb|EU239584.1|[160948097]
203: EU239583
  Homo sapiens isolate PH-1 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948096|gb|EU239583.1|[160948096]
204: EU239582
  Homo sapiens isolate Ar135 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948095|gb|EU239582.1|[160948095]
205: EU239581
  Homo sapiens isolate Ar128 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948094|gb|EU239581.1|[160948094]
206: EU239580
  Homo sapiens isolate Ar126 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948093|gb|EU239580.1|[160948093]
207: EU239579
  Homo sapiens isolate Ar102 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948092|gb|EU239579.1|[160948092]
208: EU239578
  Homo sapiens isolate Ar85 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948091|gb|EU239578.1|[160948091]
209: EU239577
  Homo sapiens isolate Ar74 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948090|gb|EU239577.1|[160948090]
210: EU239576
  Homo sapiens isolate Ar68 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948089|gb|EU239576.1|[160948089]
211: EU239575
  Homo sapiens isolate Ar67 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948088|gb|EU239575.1|[160948088]
212: EU239574
  Homo sapiens isolate Ar58 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948087|gb|EU239574.1|[160948087]
213: EU239573
  Homo sapiens isolate Ar57 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948086|gb|EU239573.1|[160948086]
214: EU239572
  Homo sapiens isolate Ar56 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948085|gb|EU239572.1|[160948085]
215: EU239571
  Homo sapiens isolate Ar53 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948084|gb|EU239571.1|[160948084]
216: EU239570
  Homo sapiens isolate Ar48 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948083|gb|EU239570.1|[160948083]
217: EU239569
  Homo sapiens isolate Ar42 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948082|gb|EU239569.1|[160948082]
218: EU239568
  Homo sapiens isolate Ar38 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948081|gb|EU239568.1|[160948081]
219: EU239567
  Homo sapiens isolate Ar34 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948080|gb|EU239567.1|[160948080]
220: EU239566
  Homo sapiens isolate Ar22 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948079|gb|EU239566.1|[160948079]
221: EU239565
  Homo sapiens isolate Ar21 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948078|gb|EU239565.1|[160948078]
222: EU239564
  Homo sapiens isolate Ar20 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948077|gb|EU239564.1|[160948077]
223: EU239563
  Homo sapiens isolate Ar19 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948076|gb|EU239563.1|[160948076]
224: EU239562
  Homo sapiens isolate Ar16 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948075|gb|EU239562.1|[160948075]
225: EU239561
  Homo sapiens isolate Ar15 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948074|gb|EU239561.1|[160948074]
226: EU239560
  Homo sapiens isolate Ar2 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948073|gb|EU239560.1|[160948073]
227: EU239559
  Homo sapiens isolate pH24E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948072|gb|EU239559.1|[160948072]
228: EU239558
  Homo sapiens isolate pH23E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948071|gb|EU239558.1|[160948071]
229: EU239557
  Homo sapiens isolate pH22E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948070|gb|EU239557.1|[160948070]
230: EU239556
  Homo sapiens isolate pH21E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948069|gb|EU239556.1|[160948069]
231: EU239555
  Homo sapiens isolate pH20E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948068|gb|EU239555.1|[160948068]
232: EU239554
  Homo sapiens isolate pH19E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948067|gb|EU239554.1|[160948067]
233: EU239553
  Homo sapiens isolate pH18E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948066|gb|EU239553.1|[160948066]
234: EU239552
  Homo sapiens isolate pH17E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948065|gb|EU239552.1|[160948065]
235: EU239551
  Homo sapiens isolate pH16E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948064|gb|EU239551.1|[160948064]
236: EU239550
  Homo sapiens isolate pH15E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948063|gb|EU239550.1|[160948063]
237: EU239549
  Homo sapiens isolate pH14E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948062|gb|EU239549.1|[160948062]
238: EU239548
  Homo sapiens isolate pH13E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948061|gb|EU239548.1|[160948061]
239: EU239547
  Homo sapiens isolate pH12E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948060|gb|EU239547.1|[160948060]
240: EU239546
  Homo sapiens isolate pH11E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948059|gb|EU239546.1|[160948059]
241: EU239545
  Homo sapiens isolate pH10E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948058|gb|EU239545.1|[160948058]
242: EU239544
  Homo sapiens isolate pH9E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948057|gb|EU239544.1|[160948057]
243: EU239543
  Homo sapiens isolate pH7aE D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948056|gb|EU239543.1|[160948056]
244: EU239542
  Homo sapiens isolate pH7E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948055|gb|EU239542.1|[160948055]
245: EU239541
  Homo sapiens isolate pH6E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948054|gb|EU239541.1|[160948054]
246: EU239540
  Homo sapiens isolate pH5E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948053|gb|EU239540.1|[160948053]
247: EU239539
  Homo sapiens isolate pH4E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948052|gb|EU239539.1|[160948052]
248: EU239538
  Homo sapiens isolate pH3E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948051|gb|EU239538.1|[160948051]
249: EU239537
  Homo sapiens isolate pH2E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948050|gb|EU239537.1|[160948050]
250: EU239645
  Homo sapiens isolate pH37m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948158|gb|EU239645.1|[160948158]
251: DQ900747
  Homo sapiens isolate PBOH2 control region, partial sequence; mitochondrial
gi|114224781|gb|DQ900747.1|[114224781]
252: DQ900746
  Homo sapiens isolate KU9 control region, partial sequence; mitochondrial
gi|114224780|gb|DQ900746.1|[114224780]
253: DQ900745
  Homo sapiens isolate P04 control region, partial sequence; mitochondrial
gi|114224779|gb|DQ900745.1|[114224779]
254: DQ900744
  Homo sapiens isolate P001 control region, partial sequence; mitochondrial
gi|114224778|gb|DQ900744.1|[114224778]
255: DQ900743
  Homo sapiens isolate KU61 control region, partial sequence; mitochondrial
gi|114224777|gb|DQ900743.1|[114224777]
256: DQ900749
  Homo sapiens isolate TW7 control region, partial sequence; mitochondrial
gi|114224783|gb|DQ900749.1|[114224783]
257: DQ900748
  Homo sapiens isolate KPLN1 control region, partial sequence; mitochondrial
gi|114224782|gb|DQ900748.1|[114224782]
258: DQ900742
  Homo sapiens isolate KU60 control region, partial sequence; mitochondrial
gi|114224776|gb|DQ900742.1|[114224776]
259: DQ233635
  Homo sapiens chromosome 16 from India genomic sequence
gi|78100381|gb|DQ233635.1|[78100381]
260: DQ200830
  Homo sapiens isolate 35T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862246|gb|DQ200830.1|[77862246]
261: DQ200829
  Homo sapiens isolate 35N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862245|gb|DQ200829.1|[77862245]
262: DQ200828
  Homo sapiens isolate 60T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862244|gb|DQ200828.1|[77862244]
263: DQ200827
  Homo sapiens isolate 60N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862243|gb|DQ200827.1|[77862243]
264: DQ200826
  Homo sapiens isolate 14T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862242|gb|DQ200826.1|[77862242]
265: DQ200825
  Homo sapiens isolate 14N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862241|gb|DQ200825.1|[77862241]
266: DQ200824
  Homo sapiens isolate 41T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862240|gb|DQ200824.1|[77862240]
267: DQ200823
  Homo sapiens isolate 41N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862239|gb|DQ200823.1|[77862239]
268: DQ200822
  Homo sapiens isolate 46-TUMOR-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862238|gb|DQ200822.1|[77862238]
269: DQ200821
  Homo sapiens isolate 45-NORMAL-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862237|gb|DQ200821.1|[77862237]
270: DQ200820
  Homo sapiens isolate 58T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862236|gb|DQ200820.1|[77862236]
271: DQ200819
  Homo sapiens isolate 58N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862235|gb|DQ200819.1|[77862235]
272: DQ200818
  Homo sapiens isolate K50-TUMOR-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862234|gb|DQ200818.1|[77862234]
273: DQ200817
  Homo sapiens isolate K49-NORMAL-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862233|gb|DQ200817.1|[77862233]
274: DQ176764
  Homo sapiens isolate UB31 control region, partial sequence; mitochondrial
gi|74273800|gb|DQ176764.1|[74273800]
275: DQ176763
  Homo sapiens isolate MMB46 control region, partial sequence; mitochondrial
gi|74273799|gb|DQ176763.1|[74273799]
276: DQ176762
  Homo sapiens isolate GB26 control region, partial sequence; mitochondrial
gi|74273798|gb|DQ176762.1|[74273798]
277: DQ176761
  Homo sapiens isolate GB14 control region, partial sequence; mitochondrial
gi|74273797|gb|DQ176761.1|[74273797]
278: DQ176760
  Homo sapiens isolate 43 control region, partial sequence; mitochondrial
gi|74273699|gb|DQ176760.1|[74273699]
279: DQ176759
  Homo sapiens isolate 34n control region, partial sequence; mitochondrial
gi|74273698|gb|DQ176759.1|[74273698]
280: DQ176758
  Homo sapiens isolate 29 control region, partial sequence; mitochondrial
gi|74273697|gb|DQ176758.1|[74273697]
281: DQ176757
  Homo sapiens isolate 27n control region, partial sequence; mitochondrial
gi|74273696|gb|DQ176757.1|[74273696]
282: DQ143207
  Homo sapiens isolate 37-T-HVR2-Kashmir control region, partial sequence; mitochondrial
gi|75678082|gb|DQ143207.1|[75678082]
283: DQ143206
  Homo sapiens isolate 37-N-HVR2-Kashmir control region, partial sequence; mitochondrial
gi|75678081|gb|DQ143206.1|[75678081]
284: DQ143205
  Homo sapiens isolate 32-T-HVR2-Kashmir control region, partial sequence; mitochondrial
gi|75678080|gb|DQ143205.1|[75678080]
285: DQ143204
  Homo sapiens isolate 32-N-HVR2-Kashmir control region, partial sequence; mitochondrial
gi|75678079|gb|DQ143204.1|[75678079]
286: DQ143203
  Homo sapiens isolate 21-T-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678078|gb|DQ143203.1|[75678078]
287: DQ143202
  Homo sapiens isolate 21-N-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678077|gb|DQ143202.1|[75678077]
288: DQ143201
  Homo sapiens isolate 13-T-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678076|gb|DQ143201.1|[75678076]
289: DQ143200
  Homo sapiens isolate 13-N-Hvr2-Delhi control region, partial sequence; mitochondrial
gi|75678075|gb|DQ143200.1|[75678075]
290: DQ143199
  Homo sapiens isolate 19-T-Hvr2-Delhi control region, partial sequence; mitochondrial
gi|75678074|gb|DQ143199.1|[75678074]
291: DQ143198
  Homo sapiens isolate 19-N-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678073|gb|DQ143198.1|[75678073]
292: DQ143197
  Homo sapiens isolate 5-T-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678072|gb|DQ143197.1|[75678072]
293: DQ143196
  Homo sapiens isolate 5-N-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678071|gb|DQ143196.1|[75678071]
294: DQ143195
  Homo sapiens isolate 30-T-Kashmir-HVR1 control region, partial sequence; mitochondrial
gi|75678070|gb|DQ143195.1|[75678070]
295: DQ143194
  Homo sapiens isolate 30-N-Kashmir-HVR1 control region, partial sequence; mitochondrial
gi|75678069|gb|DQ143194.1|[75678069]
296: DQ143193
  Homo sapiens isolate 25-T-Kashmir-HVR1 control region, partial sequence; mitochondrial
gi|75678068|gb|DQ143193.1|[75678068]
297: DQ143192
  Homo sapiens isolate 25-N-Kashmir-HVR1 control region, partial sequence; mitochondrial
gi|75678067|gb|DQ143192.1|[75678067]
298: DQ143191
  Homo sapiens isolate 31-T-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678066|gb|DQ143191.1|[75678066]
299: DQ143190
  Homo sapiens isolate 31-N-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678065|gb|DQ143190.1|[75678065]
300: DQ143188
  Homo sapiens isolate 7-N-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678063|gb|DQ143188.1|[75678063]
301: DQ143187
  Homo sapiens isolate 5-T-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678062|gb|DQ143187.1|[75678062]
302: DQ143186
  Homo sapiens isolate 5-N-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678061|gb|DQ143186.1|[75678061]
303: DQ143185
  Homo sapiens isolate 3-T-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678060|gb|DQ143185.1|[75678060]
304: DQ143184
  Homo sapiens isolate 3-N-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678059|gb|DQ143184.1|[75678059]
305: DQ143189
  Homo sapiens isolate 7-T-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678064|gb|DQ143189.1|[75678064]
306: AY899182
  Homo sapiens clone B16 control region, partial sequence; mitochondrial
gi|58702355|gb|AY899182.1|[58702355]
307: AY899183
  Homo sapiens clone BHC156 control region, partial sequence; mitochondrial
gi|58702372|gb|AY899183.1|[58702372]
308: AY899184
  Homo sapiens clone BHC27 control region, partial sequence; mitochondrial
gi|58702387|gb|AY899184.1|[58702387]
309: AY899185
  Homo sapiens clone BVIJ control region, partial sequence; mitochondrial
gi|58702414|gb|AY899185.1|[58702414]
310: AY899186
  Homo sapiens clone PP64 control region, partial sequence; mitochondrial
gi|58702435|gb|AY899186.1|[58702435]
311: AY899187
  Homo sapiens clone PP70 control region, partial sequence; mitochondrial
gi|58702453|gb|AY899187.1|[58702453]
312: AY899188
  Homo sapiens clone PP76 control region, partial sequence; mitochondrial
gi|58702475|gb|AY899188.1|[58702475]
313: AY899189
  Homo sapiens clone PSUR control region, partial sequence; mitochondrial
gi|58702495|gb|AY899189.1|[58702495]
314: AY899190
  Homo sapiens clone S18 control region, partial sequence; mitochondrial
gi|58702515|gb|AY899190.1|[58702515]
315: AY899191
  Homo sapiens clone SST4 control region, partial sequence; mitochondrial
gi|58702548|gb|AY899191.1|[58702548]
316: AY899193
  Homo sapiens clone UD50 control region, partial sequence; mitochondrial
gi|58702590|gb|AY899193.1|[58702590]
317: AY899194
  Homo sapiens clone UHC139 control region, partial sequence; mitochondrial
gi|58702602|gb|AY899194.1|[58702602]
318: AY642028
  Homo sapiens clone JKR148 HVRII control region, partial sequence; mitochondrial
gi|50919508|gb|AY642028.1|[50919508]
319: AY642024
  Homo sapiens clone JKR116 HVRII control region, partial sequence; mitochondrial
gi|50919504|gb|AY642024.1|[50919504]
320: AY642025
  Homo sapiens clone JKR131 HVRII control region, partial sequence; mitochondrial
gi|50919505|gb|AY642025.1|[50919505]
321: AY642026
  Homo sapiens clone JKR126 HVRII control region, partial sequence; mitochondrial
gi|50919506|gb|AY642026.1|[50919506]
322: AY642027
  Homo sapiens clone JKR114 HVRII control region, partial sequence; mitochondrial
gi|50919507|gb|AY642027.1|[50919507]

323: AY642029
  Homo sapiens clone JKKM62 HVRII control region, partial sequence; mitochondrial
gi|50919509|gb|AY642029.1|[50919509]

324: AY642030
  Homo sapiens clone JKKM18 HVRII control region, partial sequence; mitochondrial
gi|50919510|gb|AY642030.1|[50919510]
325: AY642031
  Homo sapiens clone JKKM32 HVRII control region, partial sequence; mitochondrial
gi|50919511|gb|AY642031.1|[50919511]
326: AY642032
  Homo sapiens clone JKSV24 HVRII control region, partial sequence; mitochondrial
gi|50919512|gb|AY642032.1|[50919512]
327: AY642033
  Homo sapiens clone JKSV14 HVRII control region, partial sequence; mitochondrial
gi|50919513|gb|AY642033.1|[50919513]
328: AY642034
  Homo sapiens clone kp49 HVRI control region, partial sequence; mitochondrial
gi|50919518|gb|AY642034.1|[50919518]
329: AY642035
  Homo sapiens clone kp16 HVRI control region, partial sequence; mitochondrial
gi|50919519|gb|AY642035.1|[50919519]
330: AY642036
  Homo sapiens clone km83 HVRI control region, partial sequence; mitochondrial
gi|50919520|gb|AY642036.1|[50919520]
331: AY642037
  Homo sapiens clone km22 HVRI control region, partial sequence; mitochondrial
gi|50919521|gb|AY642037.1|[50919521]
332: AY642038
  Homo sapiens clone kp7 HVRI control region, partial sequence; mitochondrial
gi|50919522|gb|AY642038.1|[50919522]
333: AY642039
  Homo sapiens clone kp5 HVRI control region, partial sequence; mitochondrial
gi|50919523|gb|AY642039.1|[50919523]
334: AY642040
  Homo sapiens clone kp74 HVRI control region, partial sequence; mitochondrial
gi|50919524|gb|AY642040.1|[50919524]
335: AY642017
  Homo sapiens clone bi31 HVRII control region, partial sequence; mitochondrial
gi|50956614|gb|AY642017.1|[50956614]
336: AY642018
  Homo sapiens clone up70 HVRII control region, partial sequence; mitochondrial
gi|50956615|gb|AY642018.1|[50956615]
337: AY641992
  Homo sapiens chromosome Y SRY4064 region genomic sequence
gi|50956589|gb|AY641992.1|[50956589]
338: AY641993
  Homo sapiens clone JKSV15 HVRII control region, partial sequence; mitochondrial
gi|50956590|gb|AY641993.1|[50956590]
339: AY641994
  Homo sapiens clone JKR4 HVRI control region, partial sequence; mitochondrial
gi|50956591|gb|AY641994.1|[50956591]
340: AY641995
  Homo sapiens clone JKDN26 HVRII control region, partial sequence; mitochondrial
gi|50956592|gb|AY641995.1|[50956592]
341: AY641996
  Homo sapiens clone JKMC10 HVRII control region, partial sequence; mitochondrial
gi|50956593|gb|AY641996.1|[50956593]
342: AY641997
  Homo sapiens clone JKKM99 HVRII control region, partial sequence; mitochondrial
gi|50956594|gb|AY641997.1|[50956594]
343: AY641998
  Homo sapiens clone bi10 HVRII control region, partial sequence; mitochondrial
gi|50956595|gb|AY641998.1|[50956595]
344: AY641999
  Homo sapiens clone bi45 HVRII control region, partial sequence; mitochondrial
gi|50956596|gb|AY641999.1|[50956596]
345: AY642000
  Homo sapiens clone bi48 HVRII control region, partial sequence; mitochondrial
gi|50956597|gb|AY642000.1|[50956597]

346: AY642001
  Homo sapiens clone bi61 HVRII control region, partial sequence; mitochondrial
gi|50956598|gb|AY642001.1|[50956598]
347: AY642002
  Homo sapiens clone bi72 HVRII control region, partial sequence; mitochondrial
gi|50956599|gb|AY642002.1|[50956599]
348: AY642003
  Homo sapiens clone bi91 HVRII control region, partial sequence; mitochondrial
gi|50956600|gb|AY642003.1|[50956600]
349: AY642004
  Homo sapiens clone bi13 HVRII control region, partial sequence; mitochondrial
gi|50956601|gb|AY642004.1|[50956601]
350: AY642005
  Homo sapiens clone bi27 HVRII control region, partial sequence; mitochondrial
gi|50956602|gb|AY642005.1|[50956602]
351: AY642006
  Homo sapiens clone bi55 HVRII control region, partial sequence; mitochondrial
gi|50956603|gb|AY642006.1|[50956603]
352: AY642007
  Homo sapiens clone si24 HVRII control region, partial sequence; mitochondrial
gi|50956604|gb|AY642007.1|[50956604]
353: AY642008
  Homo sapiens clone si28 HVRII control region, partial sequence; mitochondrial
gi|50956605|gb|AY642008.1|[50956605]
354: AY642009
  Homo sapiens clone pb36 HVRII control region, partial sequence; mitochondrial
gi|50956606|gb|AY642009.1|[50956606]
355: AY642010
  Homo sapiens clone up49 HVRII control region, partial sequence; mitochondrial
gi|50956607|gb|AY642010.1|[50956607]
356: AY642011
  Homo sapiens clone up75 HVRII control region, partial sequence; mitochondrial
gi|50956608|gb|AY642011.1|[50956608]
357: AY642012
  Homo sapiens clone upD4 HVRII control region, partial sequence; mitochondrial
gi|50956609|gb|AY642012.1|[50956609]
358: AY642013
  Homo sapiens clone si23 HVRII control region, partial sequence; mitochondrial
gi|50956610|gb|AY642013.1|[50956610]
359: AY642014
  Homo sapiens clone si103 HVRII control region, partial sequence; mitochondrial
gi|50956611|gb|AY642014.1|[50956611]
360: AY642015
  Homo sapiens clone pb15 HVRII control region, partial sequence; mitochondrial
gi|50956612|gb|AY642015.1|[50956612]
361: AY642016
  Homo sapiens clone pb19 HVRII control region, partial sequence; mitochondrial
gi|50956613|gb|AY642016.1|[50956613]
362: AY642019
  Homo sapiens clone bi57 HVRII control region, partial sequence; mitochondrial
gi|50956616|gb|AY642019.1|[50956616]
363: AY642020
  Homo sapiens clone si153 HVRII control region, partial sequence; mitochondrial
gi|50956617|gb|AY642020.1|[50956617]
364: AY642021
  Homo sapiens clone pb57 HVRII control region, partial sequence; mitochondrial
gi|50956618|gb|AY642021.1|[50956618]
365: AY642022
  Homo sapiens clone up41 HVRII control region, partial sequence; mitochondrial
gi|50956619|gb|AY642022.1|[50956619]
366: AY642023
  Homo sapiens clone up64 HVRII control region, partial sequence; mitochondrial
gi|50956620|gb|AY642023.1|[50956620]
367: AY613989
  Homo sapiens interleukin 6 gene, promoter region and exon 1
gi|50428878|gb|AY613989.1|[50428878]
368: AY059373
  Homo sapiens transforming growth factor beta 1 (TGFB1) gene, partial cds
gi|45602839|gb|AY059373.2|[45602839]
369: AY577521
  Homo sapiens Fas gene, exon 1 and 5' UTR
gi|50295648|gb|AY577521.1|[50295648]
370: AY576686
  Homo sapiens interferon-gamma gene, promoter region
gi|50253999|gb|AY576686.1|[50253999]
371: AY576687
  Homo sapiens clone VR transforming growth factor-beta 1 gene, exon 1 and partial cds
gi|50428874|gb|AY576687.1|[50428874]
372: AY576688
  Homo sapiens clone VLL transforming growth factor-beta 1 gene, exon 1 and partial cds
gi|50428876|gb|AY576688.1|[50428876]
373: AY345602
  Homo sapiens clone 2T microsatellite D17S379 sequence
gi|33590478|gb|AY345602.1|[33590478]
374: AY345601
  Homo sapiens clone 1 microsatellite D17S379 sequence
gi|33590477|gb|AY345601.1|[33590477]
375: AY343912
  Homo sapiens chromosome 17 map 17q21-23 unknown mRNA, partial sequence
gi|37813575|gb|AY343912.1|[37813575]
376: AY203963
  Homo sapiens clone 2 type II hair keratin gene, partial cds
gi|37781622|gb|AY203963.1|[37781622]
377: AY152545
  Homo sapiens clone SK3 type II keratin (KRTHB6) gene, exon 7 and partial cds
gi|37722558|gb|AY152545.1|[37722558]
378: AY152544
  Homo sapiens clone SK2 type II keratin (KRTHB6) gene, exon 7 and partial cds
gi|37722556|gb|AY152544.1|[37722556]
379: AY152543
  Homo sapiens clone SK1 type II keratin (KRTHB6) gene, exon 7 and partial cds
gi|37722554|gb|AY152543.1|[37722554]
380: AY151039
  Homo sapiens breast cancer susceptibility protein BRCA2 gene, exon 2 and partial cds
gi|23506222|gb|AY151039.1|[23506222]
381: AF542199
  Homo sapiens clone ASB MT-53 mitochondrial control region, partial sequence
gi|23344703|gb|AF542199.1|[23344703]
382: AF542198
  Homo sapiens clone ASB MT-Vibs mitochondrial control region, partial sequence
gi|23344702|gb|AF542198.1|[23344702]
383: AF542197
  Homo sapiens clone ASB MT-70 mitochondrial control region, partial sequence
gi|23344701|gb|AF542197.1|[23344701]
384: AF542196
  Homo sapiens clone ASB MT-63 mitochondrial control region, partial sequence
gi|23344700|gb|AF542196.1|[23344700]
385: AF542195
  Homo sapiens clone ASB MT-49 mitochondrial control region, partial sequence
gi|23344699|gb|AF542195.1|[23344699]
386: AF542194
  Homo sapiens clone ASB MT-7 mitochondrial control region, partial sequence
gi|23344698|gb|AF542194.1|[23344698]
387: AF542193
  Homo sapiens clone ASB MT-ST10 mitochondrial control region, partial sequence
gi|23344697|gb|AF542193.1|[23344697]
388: AF542192
  Homo sapiens clone ASB MT-30 mitochondrial control region, partial sequence
gi|23344696|gb|AF542192.1|[23344696]
389: AY123848
  Homo sapiens type II hair-specific keratin (KRTHB1) gene, partial cds
gi|22212272|gb|AY123848.1|[22212272]
390: AY121753
  Homo sapiens type II basic hair keratin (KRTHB1) gene, introns 6 and 7, exon 7 and partial cds
gi|22415732|gb|AY121753.1|[22415732]
391: AF467450
  Homo sapiens clone ASB MT-16 mitochondrial control region, partial sequence
gi|18448911|gb|AF467450.1|[18448911]
392: AF467449
  Homo sapiens clone ASB MT-19 mitochondrial control region, partial sequence
gi|18448910|gb|AF467449.1|[18448910]
393: AF467448
  Homo sapiens clone ASB MT-10 mitochondrial control region, partial sequence
gi|18448909|gb|AF467448.1|[18448909]
394: AF467447
  Homo sapiens clone ASB MT-9a mitochondrial control region, partial sequence
gi|18448908|gb|AF467447.1|[18448908]
395: AF467446
  Homo sapiens clone ASB MT-13 mitochondrial control region, partial sequence
gi|18448907|gb|AF467446.1|[18448907]
396: AF467445
  Homo sapiens clone ASB MT-6 mitochondrial control region, partial sequence
gi|18448906|gb|AF467445.1|[18448906]
397: AF416706
  Homo sapiens hair-specific type II keratin protein (KRTHB6) gene, partial cds
gi|22725174|gb|AF416706.1|[22725174]
398: AF416705
  Homo sapiens keratin protein HB6 (KRTHB6) gene, partial cds
gi|22725172|gb|AF416705.1|[22725172]
399: AY037552
  Homo sapiens clone 1 type II hair-specific keratin (KRTHB6) gene, promoter region and partial cds
gi|21307735|gb|AY037552.1|[21307735]
400: AF378194
  Homo sapiens clone 6 interferon gamma (IFNG) gene, intron 1
gi|20513848|gb|AF378194.1|[20513848]
401: AF378193
  Homo sapiens clone 5 interferon gamma (IFNG) gene, intron 1
gi|20513847|gb|AF378193.1|[20513847]
402: AF378192
  Homo sapiens clone 4 interferon gamma (IFNG) gene, intron 1
gi|20513846|gb|AF378192.1|[20513846]
403: AF378191
  Homo sapiens clone 3 interferon gamma (IFNG) gene, intron 1
gi|20513845|gb|AF378191.1|[20513845]
404: AF378190
  Homo sapiens clone 2 interferon gamma (IFNG) gene, intron 1
gi|20513844|gb|AF378190.1|[20513844]
405: AF378189
  Homo sapiens clone 1 interferon gamma (IFNG) gene, intron 1
gi|20513843|gb|AF378189.1|[20513843]
406: AF362378
  Homo sapiens interleukin 6 (IL6) gene, promoter region and 5' untranslated region
gi|19481401|gb|AF362378.1|[19481401]
407: AF242584
  Homo sapiens pyruvate kinase M2 gene, partial cds
gi|7649148|gb|AF242584.1|AF242584[7649148]
408: AF242584
  Homo sapiens pyruvate kinase M2 gene, partial cds
gi|7649148|gb|AF242584.1|[7649148]
409: AF216940
  Gavialis gangeticus minisatellite sequence
gi|6708483|gb|AF216940.1|AF216940[6708483]
410: AF201745
  Homo sapiens minisatellite pbaML sequence
gi|6739819|gb|AF201745.1|AF201745[6739819]
411: AF185280
  Homo sapiens pyruvate kinase M2 gene, partial cds
gi|6018095|gb|AF185280.1|AF185280[6018095]
412: AF157691
  Homo sapiens minisatellite sequence
gi|5702300|gb|AF157691.1|AF157691[5702300]
413: AF157692
  Homo sapiens pyruvate kinase M2 gene, partial cds
gi|5702301|gb|AF157692.1|AF157692[5702301]
414: AF157693
  Homo sapiens frameshifted pyruvate kinase M2 gene, partial cds
gi|5702303|gb|AF157693.1|AF157693[5702303]
415: AF035471
  AF035471 Bloom syndrome B-lymphoblastoid cell line with high Sister chromatid exchanges Homo sapiens genomic, DNA sequence
gi|3746413|gb|AF035471.1|[3746413]
416: AF035470
  AF035470 Bloom syndrome B-lymphoblastoid cell line with normal Sister chromatid exchanges Homo sapiens genomic clone hgabb2, DNA sequence
gi|3746412|gb|AF035470.1|[3746412]
417: AF035469
  AF035469 Homo sapiens lymphocyte (Bamezai R) Homo sapiens genomic clone hgsb, DNA sequence
gi|3746411|gb|AF035469.1|[3746411]
418: AF035468
  AF035468 Homo sapiens Normal B-lymphoblastoid cell line Homo sapiens genomic clone hgab, DNA sequence
gi|3746410|gb|AF035468.1|[3746410]
419: AF079321
  Homo sapiens chromosome 17 clone pCMM86 map 17q, sequence tagged site
gi|4106409|gb|AF079321.1|AF079321[4106409]

Protein Database Information

1: ACF36065
  cytochrome b [Homo sapiens]
gi|194268031|gb|ACF36065.1|[194268031]
Chemical Used : 
2: ACF36064
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194268030|gb|ACF36064.1|[194268030]
Chemical Used : 
3: ACF36063
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194268029|gb|ACF36063.1|[194268029]
Chemical Used : 
4: ACF36062
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194268028|gb|ACF36062.1|[194268028]
Chemical Used : 
5: ACF36061
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194268027|gb|ACF36061.1|[194268027]
Chemical Used : 
6: ACF36060
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194268026|gb|ACF36060.1|[194268026]
Chemical Used : 
7: ACF36059
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194268025|gb|ACF36059.1|[194268025]
Chemical Used : 
8: ACF36058
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194268024|gb|ACF36058.1|[194268024]
Chemical Used : 
9: ACF36057
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194268023|gb|ACF36057.1|[194268023]
Chemical Used : 
10: ACF36056
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194268022|gb|ACF36056.1|[194268022]
Chemical Used : 
11: ACF36055
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194268021|gb|ACF36055.1|[194268021]
Chemical Used : 
12: ACF36054
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194268020|gb|ACF36054.1|[194268020]
Chemical Used : 
13: ACF36053
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194268019|gb|ACF36053.1|[194268019]
Chemical Used : 
14: ACF36052
  cytochrome b [Homo sapiens]
gi|194268017|gb|ACF36052.1|[194268017]
Chemical Used : 
15: ACF36051
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194268016|gb|ACF36051.1|[194268016]
Chemical Used : 
16: ACF36050
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194268015|gb|ACF36050.1|[194268015]
Chemical Used : 
17: ACF36049
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194268014|gb|ACF36049.1|[194268014]
Chemical Used : 
18: ACF36048
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194268013|gb|ACF36048.1|[194268013]
Chemical Used : 
19: ACF36047
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194268012|gb|ACF36047.1|[194268012]

Chemical Used : 
20: ACF36046
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194268011|gb|ACF36046.1|[194268011]
Chemical Used : 
21: ACF36045
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194268010|gb|ACF36045.1|[194268010]
Chemical Used : 
22: ACF36044
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194268009|gb|ACF36044.1|[194268009]
Chemical Used : 
23: ACF36043
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194268008|gb|ACF36043.1|[194268008]
Chemical Used : 
24: ACF36042
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194268007|gb|ACF36042.1|[194268007]
Chemical Used : 
25: ACF36041
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194268006|gb|ACF36041.1|[194268006]
Chemical Used : 
26: ACF36040
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194268005|gb|ACF36040.1|[194268005]
Chemical Used : 
27: ACF36039
  cytochrome b [Homo sapiens]
gi|194268003|gb|ACF36039.1|[194268003]
Chemical Used : 
28: ACF36038
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194268002|gb|ACF36038.1|[194268002]
Chemical Used : 
29: ACF36037
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194268001|gb|ACF36037.1|[194268001]
Chemical Used : 
30: ACF36036
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194268000|gb|ACF36036.1|[194268000]
Chemical Used : 
31: ACF36035
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267999|gb|ACF36035.1|[194267999]
Chemical Used : 
32: ACF36034
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267998|gb|ACF36034.1|[194267998]
Chemical Used : 
33: ACF36033
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267997|gb|ACF36033.1|[194267997]
Chemical Used : 
34: ACF36032
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267996|gb|ACF36032.1|[194267996]
Chemical Used : 
35: ACF36031
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267995|gb|ACF36031.1|[194267995]
Chemical Used : 
36: ACF36030
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267994|gb|ACF36030.1|[194267994]
Chemical Used : 
37: ACF36029
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267993|gb|ACF36029.1|[194267993]
Chemical Used : 
38: ACF36028
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267992|gb|ACF36028.1|[194267992]
Chemical Used : 
39: ACF36027
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267991|gb|ACF36027.1|[194267991]
Chemical Used : 
40: ACF36026
  cytochrome b [Homo sapiens]
gi|194267989|gb|ACF36026.1|[194267989]
Chemical Used : 
41: ACF36025
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267988|gb|ACF36025.1|[194267988]
Chemical Used : 
42: ACF36024
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267987|gb|ACF36024.1|[194267987]
Chemical Used : 
43: ACF36023
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267986|gb|ACF36023.1|[194267986]
Chemical Used : 
44: ACF36022
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267985|gb|ACF36022.1|[194267985]
Chemical Used : 
45: ACF36021
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267984|gb|ACF36021.1|[194267984]
Chemical Used : 
46: ACF36020
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267983|gb|ACF36020.1|[194267983]
Chemical Used : 
47: ACF36019
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267982|gb|ACF36019.1|[194267982]
Chemical Used : 
48: ACF36018
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267981|gb|ACF36018.1|[194267981]
Chemical Used : 
49: ACF36017
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267980|gb|ACF36017.1|[194267980]
Chemical Used : 
50: ACF36016
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267979|gb|ACF36016.1|[194267979]
Chemical Used : 
51: ACF36015
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267978|gb|ACF36015.1|[194267978]
Chemical Used : 
52: ACF36014
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267977|gb|ACF36014.1|[194267977]
Chemical Used : 
53: ACF36013
  cytochrome b [Homo sapiens]
gi|194267975|gb|ACF36013.1|[194267975]
Chemical Used : 
54: ACF36012
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267974|gb|ACF36012.1|[194267974]
Chemical Used : 
55: ACF36011
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267973|gb|ACF36011.1|[194267973]
Chemical Used : 
56: ACF36010
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267972|gb|ACF36010.1|[194267972]
Chemical Used : 
57: ACF36009
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267971|gb|ACF36009.1|[194267971]
Chemical Used : 
58: ACF36008
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267970|gb|ACF36008.1|[194267970]
Chemical Used : 
59: ACF36007
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267969|gb|ACF36007.1|[194267969]
Chemical Used : 
60: ACF36006
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267968|gb|ACF36006.1|[194267968]
Chemical Used : 
61: ACF36005
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267967|gb|ACF36005.1|[194267967]
Chemical Used : 
62: ACF36004
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267966|gb|ACF36004.1|[194267966]
Chemical Used : 
63: ACF36003
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267965|gb|ACF36003.1|[194267965]
Chemical Used : 
64: ACF36002
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267964|gb|ACF36002.1|[194267964]
Chemical Used : 
65: ACF36001
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267963|gb|ACF36001.1|[194267963]
Chemical Used : 
66: ACF36000
  cytochrome b [Homo sapiens]
gi|194267961|gb|ACF36000.1|[194267961]
Chemical Used : 
67: ACF35999
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267960|gb|ACF35999.1|[194267960]
Chemical Used : 
68: ACF35998
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267959|gb|ACF35998.1|[194267959]
Chemical Used : 
69: ACF35997
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267958|gb|ACF35997.1|[194267958]
Chemical Used : 
70: ACF35996
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267957|gb|ACF35996.1|[194267957]
Chemical Used : 
71: ACF35995
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267956|gb|ACF35995.1|[194267956]
Chemical Used : 
72: ACF35994
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267955|gb|ACF35994.1|[194267955]
Chemical Used : 
73: ACF35993
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267954|gb|ACF35993.1|[194267954]
Chemical Used : 
74: ACF35992
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267953|gb|ACF35992.1|[194267953]
Chemical Used : 
75: ACF35991
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267952|gb|ACF35991.1|[194267952]
Chemical Used : 
76: ACF35990
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267951|gb|ACF35990.1|[194267951]
Chemical Used : 
77: ACF35989
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267950|gb|ACF35989.1|[194267950]
Chemical Used : 
78: ACF35988
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267949|gb|ACF35988.1|[194267949]
Chemical Used : 
79: ACF35987
  cytochrome b [Homo sapiens]
gi|194267947|gb|ACF35987.1|[194267947]
Chemical Used : 
80: ACF35986
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267946|gb|ACF35986.1|[194267946]
Chemical Used : 
81: ACF35985
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267945|gb|ACF35985.1|[194267945]
Chemical Used : 
82: ACF35984
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267944|gb|ACF35984.1|[194267944]
Chemical Used : 
83: ACF35983
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267943|gb|ACF35983.1|[194267943]
Chemical Used : 
84: ACF35982
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267942|gb|ACF35982.1|[194267942]
Chemical Used : 
85: ACF35981
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267941|gb|ACF35981.1|[194267941]
Chemical Used : 
86: ACF35980
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267940|gb|ACF35980.1|[194267940]
Chemical Used : 
87: ACF35979
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267939|gb|ACF35979.1|[194267939]
Chemical Used : 
88: ACF35978
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267938|gb|ACF35978.1|[194267938]
Chemical Used : 
89: ACF35977
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267937|gb|ACF35977.1|[194267937]
Chemical Used : 
90: ACF35976
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267936|gb|ACF35976.1|[194267936]
Chemical Used : 
91: ACF35975
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267935|gb|ACF35975.1|[194267935]
Chemical Used : 
92: ACF35974
  cytochrome b [Homo sapiens]
gi|194267933|gb|ACF35974.1|[194267933]
Chemical Used : 
93: ACF35973
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267932|gb|ACF35973.1|[194267932]
Chemical Used : 
94: ACF35972
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267931|gb|ACF35972.1|[194267931]
Chemical Used : 
95: ACF35971
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267930|gb|ACF35971.1|[194267930]
Chemical Used : 
96: ACF35970
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267929|gb|ACF35970.1|[194267929]
Chemical Used : 
97: ACF35969
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267928|gb|ACF35969.1|[194267928]
Chemical Used : 
98: ACF35968
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267927|gb|ACF35968.1|[194267927]
Chemical Used : 
99: ACF35967
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267926|gb|ACF35967.1|[194267926]
Chemical Used : 
100: ACF35966
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267925|gb|ACF35966.1|[194267925]
Chemical Used : 
101: ACF35965
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267924|gb|ACF35965.1|[194267924]
Chemical Used : 
102: ACF35964
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267923|gb|ACF35964.1|[194267923]
Chemical Used : 
103: ACF35963
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267922|gb|ACF35963.1|[194267922]
Chemical Used : 
104: ACF35962
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267921|gb|ACF35962.1|[194267921]
Chemical Used : 
105: ACF35961
  cytochrome b [Homo sapiens]
gi|194267919|gb|ACF35961.1|[194267919]
Chemical Used : 
106: ACF35960
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267918|gb|ACF35960.1|[194267918]
Chemical Used : 
107: ACF35959
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267917|gb|ACF35959.1|[194267917]
Chemical Used : 
108: ACF35958
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267916|gb|ACF35958.1|[194267916]
Chemical Used : 
109: ACF35957
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267915|gb|ACF35957.1|[194267915]
Chemical Used : 
110: ACF35956
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267914|gb|ACF35956.1|[194267914]
Chemical Used : 
111: ACF35955
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267913|gb|ACF35955.1|[194267913]
Chemical Used : 
112: ACF35954
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267912|gb|ACF35954.1|[194267912]
Chemical Used : 
113: ACF35953
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267911|gb|ACF35953.1|[194267911]
Chemical Used : 
114: ACF35952
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267910|gb|ACF35952.1|[194267910]
Chemical Used : 
115: ACF35951
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267909|gb|ACF35951.1|[194267909]
Chemical Used : 
116: ACF35950
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267908|gb|ACF35950.1|[194267908]
Chemical Used : 
117: ACF35949
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267907|gb|ACF35949.1|[194267907]
Chemical Used : 
118: ACF35948
  cytochrome b [Homo sapiens]
gi|194267905|gb|ACF35948.1|[194267905]
Chemical Used : 
119: ACF35947
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267904|gb|ACF35947.1|[194267904]
Chemical Used : 
120: ACF35946
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267903|gb|ACF35946.1|[194267903]
Chemical Used : 
121: ACF35944
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267901|gb|ACF35944.1|[194267901]
Chemical Used : 
122: ACF35943
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267900|gb|ACF35943.1|[194267900]
Chemical Used : 
123: ACF35942
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267899|gb|ACF35942.1|[194267899]
Chemical Used : 
124: ACF35941
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267898|gb|ACF35941.1|[194267898]
Chemical Used : 
125: ACF35940
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267897|gb|ACF35940.1|[194267897]
Chemical Used : 
126: ACF35939
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267896|gb|ACF35939.1|[194267896]
Chemical Used : 
127: ACF35938
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267895|gb|ACF35938.1|[194267895]
Chemical Used : 
128: ACF35937
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267894|gb|ACF35937.1|[194267894]
Chemical Used : 
129: ACF35936
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267893|gb|ACF35936.1|[194267893]
Chemical Used : 
130: ACF35935
  cytochrome b [Homo sapiens]
gi|194267891|gb|ACF35935.1|[194267891]
Chemical Used : 
131: ACF35934
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267890|gb|ACF35934.1|[194267890]
Chemical Used : 
132: ACF35933
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267889|gb|ACF35933.1|[194267889]
Chemical Used : 
133: ACF35932
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267888|gb|ACF35932.1|[194267888]
Chemical Used : 
134: ACF35931
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267887|gb|ACF35931.1|[194267887]
Chemical Used : 
135: ACF35930
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267886|gb|ACF35930.1|[194267886]
Chemical Used : 
136: ACF35929
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267885|gb|ACF35929.1|[194267885]
Chemical Used : 
137: ACF35928
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267884|gb|ACF35928.1|[194267884]
Chemical Used : 
138: ACF35927
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267883|gb|ACF35927.1|[194267883]
Chemical Used : 
139: ACF35926
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267882|gb|ACF35926.1|[194267882]
Chemical Used : 
140: ACF35925
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267881|gb|ACF35925.1|[194267881]

Chemical Used : 
141: ACF35924
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267880|gb|ACF35924.1|[194267880]
Chemical Used : 
142: ACF35923
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267879|gb|ACF35923.1|[194267879]
Chemical Used : 
143: ACF35922
  cytochrome b [Homo sapiens]
gi|194267877|gb|ACF35922.1|[194267877]
Chemical Used : 
144: ACF35921
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267876|gb|ACF35921.1|[194267876]
Chemical Used : 
145: ACF35920
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267875|gb|ACF35920.1|[194267875]
Chemical Used : 
146: ACF35919
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267874|gb|ACF35919.1|[194267874]
Chemical Used : 
147: ACF35918
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267873|gb|ACF35918.1|[194267873]
Chemical Used : 
148: ACF35916
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267871|gb|ACF35916.1|[194267871]
Chemical Used : 
149: ACF35915
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267870|gb|ACF35915.1|[194267870]
Chemical Used : 
150: ACF35914
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267869|gb|ACF35914.1|[194267869]
Chemical Used : 
151: ACF35913
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267868|gb|ACF35913.1|[194267868]
Chemical Used : 
152: ACF35912
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267867|gb|ACF35912.1|[194267867]
Chemical Used : 
153: ACF35911
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267866|gb|ACF35911.1|[194267866]
Chemical Used : 
154: ACF35910
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267865|gb|ACF35910.1|[194267865]
Chemical Used : 
155: ACF35909
  cytochrome b [Homo sapiens]
gi|194267863|gb|ACF35909.1|[194267863]
Chemical Used : 
156: ACF35908
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267862|gb|ACF35908.1|[194267862]
Chemical Used : 
157: ACF35907
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267861|gb|ACF35907.1|[194267861]
Chemical Used : 
158: ACF35906
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267860|gb|ACF35906.1|[194267860]
Chemical Used : 
159: ACF35904
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267858|gb|ACF35904.1|[194267858]
Chemical Used : 
160: ACF35903
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267857|gb|ACF35903.1|[194267857]
Chemical Used : 
161: ACF35902
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267856|gb|ACF35902.1|[194267856]
Chemical Used : 
162: ACF35901
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267855|gb|ACF35901.1|[194267855]

Chemical Used : 
163: ACF35900
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267854|gb|ACF35900.1|[194267854]
Chemical Used : 
164: ACF35899
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267853|gb|ACF35899.1|[194267853]
Chemical Used : 
165: ACF35898
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267852|gb|ACF35898.1|[194267852]
Chemical Used : 
166: ACF35897
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267851|gb|ACF35897.1|[194267851]
Chemical Used : 
167: ACF35896
  cytochrome b [Homo sapiens]
gi|194267849|gb|ACF35896.1|[194267849]
Chemical Used : 
168: ACF35895
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267848|gb|ACF35895.1|[194267848]
Chemical Used : 
169: ACF35894
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267847|gb|ACF35894.1|[194267847]
Chemical Used : 
170: ACF35893
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267846|gb|ACF35893.1|[194267846]
Chemical Used : 
171: ACF35892
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267845|gb|ACF35892.1|[194267845]
Chemical Used : 
172: ACF35891
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267844|gb|ACF35891.1|[194267844]
Chemical Used : 
173: ACF35890
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267843|gb|ACF35890.1|[194267843]
Chemical Used : 
174: ACF35889
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267842|gb|ACF35889.1|[194267842]
Chemical Used : 
175: ACF35888
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267841|gb|ACF35888.1|[194267841]
Chemical Used : 
176: ACF35887
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267840|gb|ACF35887.1|[194267840]
Chemical Used : 
177: ACF35886
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267839|gb|ACF35886.1|[194267839]
Chemical Used : 
178: ACF35885
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267838|gb|ACF35885.1|[194267838]
Chemical Used : 
179: ACF35884
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267837|gb|ACF35884.1|[194267837]

Chemical Used : 
180: ACF35883
  cytochrome b [Homo sapiens]
gi|194267835|gb|ACF35883.1|[194267835]
Chemical Used : 
181: ACF35882
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267834|gb|ACF35882.1|[194267834]
Chemical Used : 
182: ACF35881
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267833|gb|ACF35881.1|[194267833]
Chemical Used : 
183: ACF35880
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267832|gb|ACF35880.1|[194267832]
Chemical Used : 
184: ACF35879
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267831|gb|ACF35879.1|[194267831]
Chemical Used : 
185: ACF35878
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267830|gb|ACF35878.1|[194267830]
Chemical Used : 
186: ACF35877
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267829|gb|ACF35877.1|[194267829]
Chemical Used : 
187: ACF35876
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267828|gb|ACF35876.1|[194267828]
Chemical Used : 
188: ACF35875
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267827|gb|ACF35875.1|[194267827]
Chemical Used : 
189: ACF35874
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267826|gb|ACF35874.1|[194267826]
Chemical Used : 
190: ACF35873
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267825|gb|ACF35873.1|[194267825]
Chemical Used : 
191: ACF35872
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267824|gb|ACF35872.1|[194267824]
Chemical Used : 
192: ACF35871
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267823|gb|ACF35871.1|[194267823]
Chemical Used : 
193: ACF35870
  cytochrome b [Homo sapiens]
gi|194267821|gb|ACF35870.1|[194267821]
Chemical Used : 
194: ACF35869
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267820|gb|ACF35869.1|[194267820]
Chemical Used : 
195: ACF35868
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267819|gb|ACF35868.1|[194267819]
Chemical Used : 
196: ACF35867
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267818|gb|ACF35867.1|[194267818]
Chemical Used : 
197: ACF35866
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267817|gb|ACF35866.1|[194267817]
Chemical Used : 
198: ACF35865
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267816|gb|ACF35865.1|[194267816]
Chemical Used : 
199: ACF35864
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267815|gb|ACF35864.1|[194267815]
Chemical Used : 
200: ACF35863
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267814|gb|ACF35863.1|[194267814]
Chemical Used : 
201: ACF35862
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267813|gb|ACF35862.1|[194267813]
Chemical Used : 
202: ACF35861
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267812|gb|ACF35861.1|[194267812]

Chemical Used : 
203: ACF35860
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267811|gb|ACF35860.1|[194267811]
Chemical Used : 
204: ACF35859
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267810|gb|ACF35859.1|[194267810]
Chemical Used : 
205: ACF35858
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267809|gb|ACF35858.1|[194267809]
Chemical Used : 
206: ACF35857
  cytochrome b [Homo sapiens]
gi|194267807|gb|ACF35857.1|[194267807]
Chemical Used : 
207: ACF35856
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267806|gb|ACF35856.1|[194267806]
Chemical Used : 
208: ACF35855
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267805|gb|ACF35855.1|[194267805]
Chemical Used : 
209: ACF35854
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267804|gb|ACF35854.1|[194267804]
Chemical Used : 
210: ACF35853
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267803|gb|ACF35853.1|[194267803]
Chemical Used : 
211: ACF35852
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267802|gb|ACF35852.1|[194267802]
Chemical Used : 
212: ACF35851
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267801|gb|ACF35851.1|[194267801]

Chemical Used : 
213: ACF35850
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267800|gb|ACF35850.1|[194267800]
Chemical Used : 
214: ACF35849
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267799|gb|ACF35849.1|[194267799]
Chemical Used : 
215: ACF35848
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267798|gb|ACF35848.1|[194267798]
Chemical Used : 
216: ACF35847
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267797|gb|ACF35847.1|[194267797]
Chemical Used : 
217: ACF35846
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267796|gb|ACF35846.1|[194267796]
Chemical Used : 
218: ACF35845
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267795|gb|ACF35845.1|[194267795]
Chemical Used : 
219: ACF35844
  cytochrome b [Homo sapiens]
gi|194267793|gb|ACF35844.1|[194267793]
Chemical Used : 
220: ACF35843
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267792|gb|ACF35843.1|[194267792]
Chemical Used : 
221: ACF35842
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267791|gb|ACF35842.1|[194267791]
Chemical Used : 
222: ACF35841
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267790|gb|ACF35841.1|[194267790]
Chemical Used : 
223: ACF35840
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267789|gb|ACF35840.1|[194267789]
Chemical Used : 
224: ACF35839
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267788|gb|ACF35839.1|[194267788]
Chemical Used : 
225: ACF35838
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267787|gb|ACF35838.1|[194267787]
Chemical Used : 
226: ACF35837
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267786|gb|ACF35837.1|[194267786]
Chemical Used : 
227: ACF35836
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267785|gb|ACF35836.1|[194267785]
Chemical Used : 
228: ACF35835
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267784|gb|ACF35835.1|[194267784]
Chemical Used : 
229: ACF35834
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267783|gb|ACF35834.1|[194267783]
Chemical Used : 
230: ACF35833
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267782|gb|ACF35833.1|[194267782]
Chemical Used : 
231: ACF35832
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267781|gb|ACF35832.1|[194267781]
Chemical Used : 
232: ACF35831
  cytochrome b [Homo sapiens]
gi|194267779|gb|ACF35831.1|[194267779]
Chemical Used : 
233: ACF35830
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267778|gb|ACF35830.1|[194267778]
Chemical Used : 
234: ACF35829
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267777|gb|ACF35829.1|[194267777]
Chemical Used : 
235: ACF35828
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267776|gb|ACF35828.1|[194267776]
Chemical Used : 
236: ACF35827
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267775|gb|ACF35827.1|[194267775]
Chemical Used : 
237: ACF35826
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267774|gb|ACF35826.1|[194267774]
Chemical Used : 
238: ACF35825
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267773|gb|ACF35825.1|[194267773]
Chemical Used : 
239: ACF35824
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267772|gb|ACF35824.1|[194267772]
Chemical Used : 
240: ACF35823
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267771|gb|ACF35823.1|[194267771]
Chemical Used : 
241: ACF35822
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267770|gb|ACF35822.1|[194267770]
Chemical Used : 
242: ACF35821
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267769|gb|ACF35821.1|[194267769]
Chemical Used : 
243: ACF35820
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267768|gb|ACF35820.1|[194267768]
Chemical Used : 
244: ACF35819
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267767|gb|ACF35819.1|[194267767]
Chemical Used : 
245: ACF35818
  cytochrome b [Homo sapiens]
gi|194267765|gb|ACF35818.1|[194267765]
Chemical Used : 
246: ACF35817
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267764|gb|ACF35817.1|[194267764]
Chemical Used : 
247: ACF35816
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267763|gb|ACF35816.1|[194267763]

Chemical Used : 
248: ACF35815
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267762|gb|ACF35815.1|[194267762]
Chemical Used : 
249: ACF35814
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267761|gb|ACF35814.1|[194267761]
Chemical Used : 
250: ACF35813
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267760|gb|ACF35813.1|[194267760]
Chemical Used : 
251: ACF35812
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267759|gb|ACF35812.1|[194267759]
Chemical Used : 
252: ACF35811
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267758|gb|ACF35811.1|[194267758]
Chemical Used : 
253: ACF35810
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267757|gb|ACF35810.1|[194267757]
Chemical Used : 
254: ACF35809
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267756|gb|ACF35809.1|[194267756]
Chemical Used : 
255: ACF35808
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267755|gb|ACF35808.1|[194267755]
Chemical Used : 
256: ACF35807
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267754|gb|ACF35807.1|[194267754]
Chemical Used : 
257: ACF35806
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267753|gb|ACF35806.1|[194267753]
Chemical Used : 
258: ACF35805
  cytochrome b [Homo sapiens]
gi|194267751|gb|ACF35805.1|[194267751]
Chemical Used : 
259: ACF35804
  NADH dehydrogenase subunit 6 [Homo sapiens]
gi|194267750|gb|ACF35804.1|[194267750]
Chemical Used : 
260: ACF35803
  NADH dehydrogenase subunit 5 [Homo sapiens]
gi|194267749|gb|ACF35803.1|[194267749]
Chemical Used : 
261: ACF35802
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267748|gb|ACF35802.1|[194267748]
Chemical Used : 
262: ACF35801
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267747|gb|ACF35801.1|[194267747]
Chemical Used : 
263: ACF35800
  NADH dehydrogenase subunit 3 [Homo sapiens]
gi|194267746|gb|ACF35800.1|[194267746]
Chemical Used : 
264: ACF35799
  cytochrome c oxidase subunit III [Homo sapiens]
gi|194267745|gb|ACF35799.1|[194267745]
Chemical Used : 
265: ACF35798
  ATP synthase F0 subunit 6 [Homo sapiens]
gi|194267744|gb|ACF35798.1|[194267744]
Chemical Used : 
266: ACF35797
  ATP synthase F0 subunit 8 [Homo sapiens]
gi|194267743|gb|ACF35797.1|[194267743]
Chemical Used : 
267: ACF35796
  cytochrome c oxidase subunit II [Homo sapiens]
gi|194267742|gb|ACF35796.1|[194267742]
Chemical Used : 
268: ACF35795
  cytochrome c oxidase subunit I [Homo sapiens]
gi|194267741|gb|ACF35795.1|[194267741]
Chemical Used : 
269: ACF35794
  NADH dehydrogenase subunit 2 [Homo sapiens]
gi|194267740|gb|ACF35794.1|[194267740]
Chemical Used : 
270: ACF35793
  NADH dehydrogenase subunit 1 [Homo sapiens]
gi|194267739|gb|ACF35793.1|[194267739]
Chemical Used : 
271: ACF35945
  NADH dehydrogenase subunit 4 [Homo sapiens]
gi|194267902|gb|ACF35945.1|[194267902]
Chemical Used : 
272: ACF35905
  NADH dehydrogenase subunit 4L [Homo sapiens]
gi|194267859|gb|ACF35905.1|[194267859]
Chemical Used : 
273: NP_002275
  keratin 86 [Homo sapiens]gi|14318422|ref|NP_002275.1|[14318422]
Chemical Used :  NP_002275
274: ACD31678
  cytochrome c oxidase subunit III [Homo sapiens]gi|187729692|gb|ACD31678.1|[187729692]
Chemical Used :  ACD31678
275: ACC97189
  cytochrome c oxidase subunit II [Homo sapiens]gi|186968864|gb|ACC97189.1|[186968864]
Chemical Used :  ACC97189
276: ACF04131
  cytochrome c oxidase subunit I [Homo sapiens]gi|192335153|gb|ACF04131.1|[192335153]
Chemical Used :  ACF04131
277: ACD31677
  ATPase subunit 6 [Homo sapiens]gi|187729691|gb|ACD31677.1|[187729691]
Chemical Used :  ACD31677
278: NP_001073847
  parkin co-regulated gene protein isoform 2 [Homo sapiens]
gi|122939202|ref|NP_001073847.1|[122939202]
Chemical Used :  NP_001073847
279: NP_001073848
  parkin co-regulated gene protein isoform 2 [Homo sapiens]
gi|122939206|ref|NP_001073848.1|[122939206]
Chemical Used :  NP_001073848
280: NP_689623
  parkin co-regulated gene protein isoform 1 [Homo sapiens]
gi|122939204|ref|NP_689623.2|[122939204]
Chemical Used :  NP_689623
281: AAF65764
  pyruvate kinase M2 [Homo sapiens]
gi|7649149|gb|AAF65764.1|[7649149]
Chemical Used :  AAF65764
282: AAF01766
  pyruvate kinase M2 [Homo sapiens]
gi|6018096|gb|AAF01766.1|[6018096]
Chemical Used :  AAF01766
283: AAD47249
  frameshifted pyruvate kinase M2 [Homo sapiens]
gi|5702304|gb|AAD47249.1|[5702304]
Chemical Used :  AAD47249
284: AAT77143
  transforming growth factor-beta 1 [Homo sapiens]
gi|50428875|gb|AAT77143.1|[50428875]
Chemical Used :  AAT77143
285: AAT77144
  transforming growth factor-beta 1 [Homo sapiens]
gi|50428877|gb|AAT77144.1|[50428877]
Chemical Used :  AAT77144
286: AAL27646
  transforming growth factor beta 1 [Homo sapiens]
gi|45602840|gb|AAL27646.2|[45602840]
Chemical Used :  AAL27646
287: AAN75227
  type II keratin [Homo sapiens]
gi|37722559|gb|AAN75227.1|[37722559]
Chemical Used :  AAN75227
288: AAN75225
  type II keratin [Homo sapiens]
gi|37722555|gb|AAN75225.1|[37722555
Chemical Used :  AAN75225
289: AAN75226
  type II keratin [Homo sapiens]
gi|37722557|gb|AAN75226.1|[37722557]
Chemical Used :  AAN75226
290: AAK68688
  type II hair-specific keratin [Homo sapiens]
gi|21307736|gb|AAK68688.1|[21307736]
Chemical Used :  AAK68688
291: AAN28944
  breast cancer susceptibility protein BRCA2 [Homo sapiens]
gi|23506223|gb|AAN28944.1|[23506223]
Chemical Used :  AAN28944
292: AAN04664
  hair-specific type II keratin protein [Homo sapiens]
gi|22725175|gb|AAN04664.1|[22725175]
Chemical Used :  AAN04664
293: AAN04663
  keratin protein HB6 [Homo sapiens]
gi|22725173|gb|AAN04663.1|[22725173]
Chemical Used :  AAN04663
294: AAM94951
  type II basic hair keratin [Homo sapiens]
gi|22415733|gb|AAM94951.1|[22415733]
Chemical Used :  AAM94951
295: AAM92877
  type II hair-specific keratin [Homo sapiens]
gi|22212273|gb|AAM92877.1|[22212273]
Chemical Used :  AAM92877
296: AAD47248
  pyruvate kinase M2 [Homo sapiens]
gi|5702302|gb|AAD47248.1|[5702302]
Chemical Used :  AAD47248
297: AAO63472
  type II hair keratin [Homo sapiens]
gi|37781623|gb|AAO63472.1|[37781623]
Chemical Used :  AAO63472

OMIM Database Information

1: *601772
  H2A HISTONE FAMILY, MEMBER X; H2AFX Gene map locus 11q23.2-q23.3
Chemical Used : 
2: 114480
  BREAST CANCER
BREAST CANCER, FAMILIAL MALE, INCLUDED
Gene map locus 17q22-q23, 17q22, 17p13.1, 16p12, 15q15.1, 14q32.3, 13q12.3, 12p12.1, 11q22.3, 11p15.5, 8q11, 5q33.2, 3q26.3, 2q34-q35, 2q33, 22q12.1
Chemical Used : 
3: SNPs
  rs56588968 has merged into rs1800795 [Homo sapiens] CACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA
Chemical Used : 
4: SNPs
  rs17777058 has merged into rs1800795 [Homo sapiens] CACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA
Chemical Used : 
5: SNPs
  rs13447445 [Homo sapiens]GTTGAGACTCTAATATTGAGACTCAT[C/G]GGAAAATCCCACATTTGATAAATCT
Chemical Used : 
6: SNPs
  rs35706870 [Homo sapiens]CCAAGGGCAGATGTGCATGGAGGCCA[A/C]GTCATTTCCTTCCCATGCTCTCATA
Chemical Used : 
7: SNPs
  rs17777058 has merged into rs1800795 [Homo sapiens] CACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA
Chemical Used : 
8: *516002
  COMPLEX I, SUBUNIT ND3; MTND3
Chemical Used : 
9: #114500
  COLORECTAL CANCER; CRC
Gene map locus 2p25, 22q13, 20q13.2-q13.3, 17q24, 17p11.2, 17p13.1, 15q15, 14q24.3, 11p11.2, 8p22-p21.3, 1p13.2, 4q32, 3q26.3, 1p35
Chemical Used : 
10: #607572
  LEPROSY, SUSCEPTIBILITY TO, 2 Gene map locus 6q25.2-q27
Chemical Used : 
11: *608427
  PARKIN COREGULATED GENE; PACRG
Gene map locus 6q25-q27
Chemical Used : 
12: *602544
  PARKIN; PARK2 FRAGILE SITE FRA6E, INCLUDED Gene map locus 6q25.2-q27
Chemical Used : 
13: *601928
  KERATIN, HAIR, BASIC, 6; KRTHB6 Gene map locus 12q13
Chemical Used : 
14: #246300
  LEPROSY, SUSCEPTIBILITY TO Gene map locus 4q32
Chemical Used : 
15: *124092
  INTERLEUKIN 10; IL10 Gene map locus 1q31-q32
Chemical Used : 
16: SNPs
  rs45484397 [Homo sapiens] ATTGTGGGTCTGGTGGTTATGGAATG[G/T]TGGTGGTAACAGTGGTGTGATGGAA
Chemical Used : 
17: SNPs
  rs41318531 [Homo sapiens] AACTGGACTCAGGCCTTTTGGCCTCA[A/G]AGAAGCTCACAGTGTGAGAGTATGA
Chemical Used : 
18: SNPs
  rs41296860 [Homo sapiens] AACTGGACTCAGGCCTTTTGGCCTCA[A/G]AGAAGCTCACAGTGTGAGAGT
Chemical Used : 
19: SNPs
  rs1800795 [Homo sapiens] CACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA AFFY, HGBASE, PGA-UW-FHCRC, SC_JCM, SNP500CANCER
Chemical Used : 
20: SNPs
  rs13447445 [Homo sapiens] GTTGAGACTCTAATATTGAGACTCAT[C/G]GGAAAATCCCACATTTGATAAATCT
Chemical Used : 
21: SNPs
  rs13447446 [Homo sapiens]
ATCTTTGTTGGAGGGTGAGGGTGGGG[A/C]CAGAGCGGGTGGGGCTGATTGGAAA

Chemical Used : 
22: SNPs
  rs35706870 [Homo sapiens] CCAAGGGCAGATGTGCATGGAGGCCA[A/C]GTCATTTCCTTCCCATGCTCTCATA
Chemical Used : 
23: SNPs
  rs13447341 [Homo sapiens] GGAGCTGGTGAAGCGGAAGCGCATCG[A/G]GGCCATCCGCGGCCAGATCCTGTCC
Chemical Used : 
24: SNPs
  rs41352448 [Homo sapiens]
ATGGATGGATGGATGGATGGATGGAT[-/GGAT]GGACAGACAGCTATAGAAATACAGA
Chemical Used : 
25: SNPs
  rs3917220 [Homo sapiens] CAAGGGACTCTAATCTACCTTGTTCT[-/T]TCTGTTCTCTTCAGAACTCCAAGCT
Chemical Used : 

Citations in the Genbank Database

:: National Centre of Applied Human Genetics ::